Primary School classroom Essay Example for Free

Primary School classroom Essay These Poets write Honestly about their Experiences. Explore the Memories Expressed in their Poems and consider what Views they are sharing about Growing Up  Carol Ann Duffy expresses her views and gives her true experiences to do with childhood and growing up. She uses a range of techniques in her poems, like similes to emphasize her feelings and emotions and imagery, where she uses metaphors to help create the picture and mood of the atmosphere of each poem. For example, the Primary School classroom. Simon Armitage also writes about everyday experiences, childhood, growing up, changes and regrets. He uses less imagery than Carol Ann Duffy, but in one particular poem Kid, he uses a great more rhyme. They both include experiences towards school life, where Carol Ann Duffy writes about the younger years and Simon Armitage writes about the older years at school. These two poets are similar in some ways, but can be quite different in others. For example, in Duffys Stealing it shares the feelings of a child who steals for no reason and Duffy adds comments from her own experiences. It can make the reader feel quite depressed and sad, whereas in I am very Bothered by Simon Armitage, it is again about a child with regret for something he did at school, but instead of being sad it uses black humour and is more horrible stench of branded skin In Mrs Tilschers Class, Carol Ann Duffy starts with you, which makes it personal and sets the scene travel up the Blue Nile.  She identifies things like Primary School aspects very well with your finger, tracing the route This is a good reminder to what children do when they are little. She creates the picture of the blackboard chalky Pyramids rubbed into dust. This suggests break time and the laugh of a bell swung by a running child creates a jolly, happy time that all the kids look forward to. This gives a comparison between home and school. This was better than home. There are more interesting things to be found at school, like enthralling books, which is obviously what she doesnt have at home.  She uses similes to describe the classroom. The classroom glowed like a sweet shop. This creates the idea of colour that a sweet shop would have.  She tells of a negative memory Brady and Hindley, which faded, like the faint, uneasy smudge of a mistake. School has so many good memories that it is able to make the bad ones disappear. She uses emotion Mrs Tilscher loved you, and alliteration good gold star, which makes the poem flow easier. It also sounds a bit like a childs expression.  A xylophones nonsense gives the impression of tuneless playing, which kids do in Primary School, they dont care about accuracy, just about having fun. It also appeals to the senses by using sounds as well as visual images.

Shooting an Elephant Literary Analysis Essay Example for Free

Shooting an Elephant Literary Analysis Essay George Orwell’s 1930 short story â€Å"Shooting an Elephant,† demonstrates the total dangers of the unlimited authority a state has and the astounding presentment of â€Å"future dystopia†. In the story, Orwell finds himself to be in an intricate situation that involves an elephant. Not only does the fate of the elephant’s life lie in Orwell’s hands, he has an audience of people behind him cheering him on, making his decision much more difficult to make. Due to the vast crowd surrounding his thoughts, Orwell kills the elephant in the end, not wanting to disappoint the people of Burma. Orwell captures the hearts of readers by revealing the struggles he has while dealing with the burden of his own beliefs and morals. Orwell’s story connects with the readers because they understand the emotions and stress one can have before making a tough decision, as well as fretting about being judged at the same time. In the beginning of his story, Orwell illustrates his position as a hated police officer. He was consistently insulted and despised by the Burmese people. The locals were always treating him poorly, but he always did his job and kept in mind their best interest. He was already somewhat of a leader in this town because of his position, but now that there is the situation with a ravaging elephant in the town, he is forced to step up and take control of the elephant. â€Å"Being the white ‘leader’, he should have been able to make an independent decision, but was influenced by the ‘natives’† (Orwell 101). Orwell has this immense pressure building up over this decision, and his emotions as â€Å"Here I was the white man with his gun, standing in front of the unarmed crowd-seemingly the leading actor of the piece; but in reality I was only an absurd puppet pushed to and fro by the will of those yellow faces behind† (101). Majority of the people in the world have been faced with a situation similar to this, taking responsibility of something that can be life changing. As Orwell demonstrates the chaos that was going on in Burma, readers can sense the feelings of what the locals are dealing with. As Orwell walks through the town to find the disasters the elephant made, he encounters the horrific scene of a dead man’s body. The elephant, which can be symbolized as a dangerous threat, imposes on the little town and deteriorates some of the Burmese foods and goods. Not only was the animal an escapee, it was also in â€Å"must†, meaning an increase in the level of aggressive behavior due to testosterone levels being high, causing the elephant to be more dangerous than ever. Because of the actions that the elephant had made, the Burmese people wanted the elephant dead under any circumstances. Feeling bad for the owner of the savaged animal, Orwell had to weigh out his options of killing the elephant. Thomas Bertonneau states, â€Å"But the elephant, of course, is well-known for its high level of intelligence, a fact which raises it out of the merely animal category; and the social structure of Burmese society under the British tends to underscore such quasi-human status. The animal is a working animal and to do work is to engage in a recognizably social activity; the animal belongs, as Orwell later discloses, to an Indian, a person below the British in the local hierarchy but above the Burmese, a person of some wealth, for the elephant is the equivalent of â€Å"a huge and costly piece of machinery† in the local economy (par. 4). Orwell recognizes the facts from both sides of this situation: (1) the elephant should be killed because of its’ violent actions, making the townspeople happy, or (2) waiting for the man who owns the elephant to get there to capture it safely and let it live. As he takes in the opinions of others, he believes he should wait for the Indian man to get there; therefore the elephant is worth much more alive than if it were dead. As the ending of the story draws to a near, Orwell is looked upon as a â€Å"hero† in the story. As he grabs the gun, the crowd roars with excitement and the fate of the elephant lies in his hands. With much regret, he shoots the elephant several times, but never actually ends his misery. Orwell takes his interpretation of storytelling to a whole new level. During Orwell’s time in Burma, he was exposed to several unethical situations, causing him to make a decision that questions his beliefs and morals. He made sure that the reader was involved into the dilemma and mindset of his world he lived in. The story is told from the experiences that Orwell had, giving his story a little more of an edge and captures the attentiveness of wanting to know more. He told the story as if it was happening to him again, allowing the reader to relive the moments as he did back then. It brought it all back to his morals, and doing what he thought was right to do.

Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity: Secondary Metabolite Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50 ±0.01, 32.61 ±0.06 and 66.54 ±0.01 respectively. Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis The Name endolichenic fungi was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows di stinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds. MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66 °N 78.40 °E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags. Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 ÃÆ'- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50ÃŽÂ ¼g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28 °C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub -cultured on PDA. Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing. The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye ® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5à ¢Ã¢â€š ¬Ã‚ ² TCCTCCGCTTATTGATATGC 3à ¢Ã¢â€š ¬Ã‚ ²) ITS5 (5à ¢Ã¢â€š ¬Ã‚ ² GGAAGTAAAAGTCGTAACAAGG 3à ¢Ã¢â€š ¬Ã‚ ²) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST ® (http://www.ncbi.nlm.nih.gov/blast/). Fermentation and extraction: The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28 ±2 °C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24]. Antibacterial Activity: To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100. Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28 °C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100. Screening for Antioxidant activity DPPH Assay: Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Whereà °Ã‚ Ã‚ Ã‚ ´blank is the absorbance of the control reaction and à °Ã‚ Ã‚ Ã‚ ´sample is the absorbance in the presence of purified molecules Determination of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50 °C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585 September October 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25 °C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent. Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100. RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro. In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens. Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2). Table. 1: Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25ÃŽÂ ¼l 50ÃŽÂ ¼l 75ÃŽÂ ¼l 100ÃŽÂ ¼l Klebsiella pneumoniae 33.56 57.75 66.63 75.94 Escherichia coli 30.93 56.79 66.75 75.66 Salmonella typhi 30.98 56.32 66.52 74.39 Proteus vulgaris 31.70 55.28 66.00 69.83 Bacillus substiles 31.67 48.06 64.86 72.61 Pseudomonas fluorescence 29.38 49.47 64.95 72.61 Staphylococcus aureus 31.67 48.06 64.86 70.94

The Fragility of Freedom Gadamerian :: Gadamer Freedom Essays

The Fragility of Freedom Gadamerian ABSTRACT: This paper examines the nature of freedom in Hang-Georg Gadamer’s hermeneutics. It focuses on the last section of Wahrheit und Methode advancing the hypothesis that Gadamer’s model of understanding is derived from his particular appropriation of the Platonic notion of the beautiful which poses a passive interpretative posture toward the object of understanding and deprives the activity of interpretation the essential creative quality of freedom. I argue that to the extent that the object of understanding presents itself as immediate revelation of truth, the interpreting subject is reduced to a mere acknowledger of truth as opposed to a creative producer. Opponents of teleological ontology and of philosophy of history have been attracted to hermeneutics as a more congenial perspective for the exploration of such issues as truth and right, knowledge and action, necessity and freedom. The appealing claim of hermeneutics is that universality need not be and should not be absolute as an ultimate end of a process of actualisation. In the view of hermeneutics, a determinate universal converts freedom to necessity however much consciousness may mediate activity. That is, even though activity engenders change, consciousness is more an expression of necessity in relation to the absolute than an expression of freedom. Indeed, in this view, teleological mediation between freedom and necessity is no reconciliation but rather a subsumption of freedom by necessity. To rehabilitate freedom, hermeneutics opts for a non-teleological history with an open, indeterminate future. The departure from teleology finds a new non-essentialist ground for truth a nd universality, namely, mutual understanding. In this paper, I examine Gadamer’s notion of mutual understanding, fusion of horizons, to assess the place reserved for freedom. I focus on Gadamer’s appropriation of the Platonic notion of the beautiful as the model of understanding and I argue that such a notion of understanding poses a passive interpretive posture toward the object of understanding, i.e. tradition or contemporary alien culture. In this model of understanding, I shall argue, the latter presents itself as immediate revelation of truth and thereby deprives interpretation of the productive quality which Gadamer would like to attribute it. I begin by providing some theoretical background to Gadamer’s notion of understanding noting its debt to Heidegger’s phenomenological ontology. I then proceed to examine Gadamer’s appeal to the Platonic dialectic of the beautiful as a model for understanding which highlights, to my mind and as I noted, the latent passivity of Gadamerian interpretati on.

The Role of Business Education in Secondary Schools Essay -- essays pa

The Role of Business Education in Secondary Schools Education and Vocational Education have many roles in today’s schools. Vocational education focuses on the future employment of the student, by using practical application. Vocational education gives students the opportunity to learn with hands-on experience. This can help in several areas of gaining an education. Most notably, this gives the student the opportunity to find out if this is what they want to do. Students will get a real-world experience very early on in their education. This experience can greatly enrich a student’s education by giving them the opportunity to become involved in activities that are relevant to their lives, therefore, becoming a source of motivation. Education provides these same experiences to a certain extent, but the connection to real-world experience is much less defined. I believe it is the obligation of an educator to help create lifelong learners out of our students. Three key elements need to be present for this to take place. Confidence, relevance and motivation must all be present. Students need to have the confidence to try and succeed, or try and fail. This may sound like a trivial example, but I believe it is essential to success. Without knowing and understanding failure, students will not be able to appreciate success and what it takes to succeed. Confidence will be gained through the trial and error that takes place in the successful business educator’s classroom. Rele...

To Rent Or Not To Rent :: essays research papers

Renting a home to live in, rather than buying a home to live in is a much wiser decision. When renting a home you are able to have free maintenance, partially included utilities and the freedom to pack up and move at anytime you wish.   Ã‚  Ã‚  Ã‚  Ã‚  We all like the luxury of being waited on, especially if it is at no cost to us. With a rental home, if the plumbing fouls up, the roof starts to leak or some other untimely mishap, free maintenance is only a phone call away for the renters because the landlord is liable for repairs on his rental properties. Whereas, the unlucky home owners better have some deep pockets when something goes awry in their household. Because a home owner does not have the free maintenance that those who rent do. The only things the home owners get are maintenance expenses and some free headaches.   Ã‚  Ã‚  Ã‚  Ã‚  Partially included utilities are a real bonus for those who rent. Some rentals have both water and trash pick up paid by the landlord. That means two extra bills the renters need not to worry about. One can water his or her grass and take long showers without having the worry of having to look forward to a large water bill. While the one who owns their own home, has to be rather limited in their water use or else they may have to pay the high water bills.   Ã‚  Ã‚  Ã‚  Ã‚  Renting homes also has a nice freedom. When a person rents, they can always up and move with a written thirty day notice given to their landlord. For instance, what if the neighborhood starts to turn into a less desirable area for residing in? Like maybe the crime rate goes up or bothersome neighbors move in next door? Well then, the renter can look for another place in a more desirable part of town and move out of their rented home. On the other hand, if a person owns their home, they either have to deal with the unfavorable changes in the neighborhood or put their house up for sale.

Secret Window Movie

Secret Window is psychological thrilled about mind that cracks right down the middle and separates two different people with totally two different personalities that is taking over. Mort Rainey is a successful writer going through unfriendly divorce from his wife, Amy. Mort suspicion his wife Amy who is secretly meeting a lover and one night he confirms his fear by following her to a nearby motel and hesitantly walks in to the room while they are in bed. His hesitation was caused by a voice in his head that was trying to persuade him to go home and forget about his suspicion. Mort is alone and bitter in his little cabin, he continues to work on his writing when stranger John Shooter comes up to his doorstep, claim Rainey stole his story. Mort tells Shooter that he wrote his first and he can prove it, but while Mort waits for the evidence to appear, Shooter starts to become more violent. Mort also tries to tell Shooter that his story was published way back before Shooter’s existed. And then he is given three days by Shooter to prove it. Mort had medical attention then maybe he would have gotten treatment for his disorder. The disorder in which I am thinking of is known as dissociation identity disorder (DID) which also called as multiple personality disorder (MPD). This disorder is a psychiatric condition which person role in multiple identities. Each has a different set of unique set of memories, emotions, behavior, and thoughts. Mort’s alter ego which was Shooter is called a â€Å"host personality† this is when he executive control of the body for the greatest percentage of time during a given amount of time. Mort has been taking prescription drugs to stabilize his mental disorder. This problem combined with cigarette and alcohol-induced psychotic disorder with delusions and with onset during intoxication may account for five murders that were committed by one of Mort’s personalities. I have known that in this multiple personality disorder therapy the hypnosis is one of the successful treatment for the person that diagnosis with this disorder. In this hypnosis therapy they ask patient to go back in their mind when traumatic events occurred in their childhood. The treatment helps them belief that those traumatic memories will permit in patient to understand the threats from their childhood is doesn’t exist anymore in their adult life. Neither I can nor has anyone I know that has been related to this movie with multiple personality disorder. I can’t imagine any of my family member or friends going through with this kind of disorder. But I have seen one of the shows on T. V. that was similar to this kind of movie. It was girl who diagnosis with this multiple personality disorder. It was hard for the parents to take care of her and her little brother together. Her brother was only 2 year old and she tries to kill her brother and she go through that traumatic events. Her parent rent another apartment so separate brother and sister from each-other. The director had done really wonderful job with this movie, but there something I see to be end different ways than the way it did end. If I were director of this movie, I would keep the most part of the movie the way it is except for the end part. I was looking for some more to it at the end. I would try to show the treatment to this disorder so it allow to understand more people how patient get treated with multiple personality disorder. And also audience can understand much better to people who deal with mental illness.